10/23/2023 0 Comments Samtools get consensus sequencesWith "-f 4" I retrieved the unmapped reads but my fasta had four sequences, while with "-F 4" I filtered out the unmapped reads, and the fasta file had one sequence with the rest empty. I am trying to interpret these correctly because I do not want to inadvertently and wrongly eliminate autosomal/non-X/Y scaffolds. TGAATTGGGCCTCTAGTTTATAATAATGAAGACCAAAAACAATGTAAATGAAAAAGGAATGATTAAATAAATTATATCATATTCATTTAATGAGAACTATGTGCCATACATACATAGTTATATAGATACATAGGTAGATACAAAGATACATAGACCATAATTTTGTAAAAATAATACAAAGAAAAAAAAGGAAGAAAGAAATGAAGGTAATGCATTCAATAGAAGACCT$ GGCAGGAAGGTTGGCTGCAGAAAGCAAAGGGCCCAGCAGGAACCCCAGGATGGTCAGCGGTGGTGGCATTTCACTCTGTCCCTTTGGAGGGATATGATTGCTGCTCCCAAGAGACACAGAAAGGTTCAGTCTGGTCTAAGCAGAGTCTGCTCCTGTCTCTATTGAACTCAACACAAGCAGGAAAATTGCATCATTCAAATGATGAAGGCCAGGTAATCCAGAGTCATGG$ĪCCGGACACCCCACCAACAGGCCCCTTCCCCCGCACACTTGGGACTGAAGATGGAAGGGTGCTGCCCGGCCGGGGGCTACGTGGGTTTAAAACTGTCCCCGTAAAAGTTTCAGATCTGATCTGAGCCAGGGCGGAGTCCTAGGTTTGGGGTGTCATTTCCTGAGCGGGGTGAGCACTGGAAGGCAGCTGATGGCTATTTCCCTGTCAGACCCATGGGAACGGCCTTGGG$ GTTTAGCATTTTAACCATACAATTCAGTAACATTAAATACATTCATATTGTTGTGCAACTTTCTGAACCATTCTCTCCACACCTTTATCTTCAAAACTAAAACTCTGTATCCATTAAATAACTCTCCATTGTCTCCCTGCCACCCAGCCCTGGCAACCATGATTCTACTTTTGTCTCTGTGAGTTTGACTATTCTAGGTATCTCATATAAATGGAATCCTATAAAGTGC$ Reply to this email directly, view it on GitHub, or unsubscribe. You are receiving this because you authored the thread. To filter out the unmapped reads use samtools -F4 myse_some.sam To retrieve the unmapped reads use samtools -f4 myse_some.sam. So please indicate what version of SAMtools/HTSlib you are using and what platform. This seems to be an issue, not a feature request. Subject: Re: Get unmapped reads from sam file ( #1389) The input sam file is about 18G, and the output was only 1.4 GB, which is sort of expected given that the genome assembly was only 1.9GB.Ĭould you please help me what is the best approach to filter the reads/scaffolds mapping to the sex chromosomes?Ĭc: Aguilar Cabezas, Juan Pablo Author I expected 88 scaffolds, but as you can see, I was only able to get 12. Error writing to FASTx files.: Inappropriate ioctl for device Samtools view 40 -b -F 4 myse_some.sam | samtools fasta 40 > autoZome.fasta Samtools fasta 48 -f 4 myse_some.sam > Autosome.fastaĪnd I got 4 scaffolds, technically, kinda correct, but I expected to have all but 4 scaffolds out of the 92. I used the following code, which I thought was to get the unmapped reads: Thus, I mapped my scaffolds to the chromosomes Y and X, and I would like to get the unmapped reads -which should be only the autosomes. I forgot that I have to only use autosome scaffolds, so I am trying to filter autosomes (bat genome) using the scaffolds of chromosome X and Y from mouse- no such assembly from bat genomes so far. I have assembled a genome, and I am trying to do a PSMC analysis. Help me Obi-Wan Kenobi, you are my only hope.Is your feature request related to a problem? Please specify. And since I am running this job in parallel for multiple samples (each producing a unique final sequence), I want to find a solution more elegant than simply renaming the sequences 1 by 1. In my case I just have 1 sample, 1 sequence (the final consensus from the alignment) so I don't know where the name is fetched. Indeed most of the questions relating to this problem deal with multiple sequences inside an alignment (chromosomes, multiple samples, etc). I checked quite a few forums and the manuals of each software, but I can't figure out what to do. In this example, the fasta sequence in the SAMPLE1.fasta file should be named ">SAMPLE1", but it is always named ">reference". Seqtk seq -aQ64 -q13 -n N SAMPLE1_consensus.fastq > SAMPLE1.fasta ![]() This is a good way to remove low quality reads, or make a BAM file restricted to a single chromosome. Samtools mpileup -uf reference.fasta SAMPLE1_aln_sorted.bam | bcftools call -c | vcf2fq > SAMPLE1_consensus.fastq bam files - they can be converted into a non-binary format ( SAM format specification here) and can also be ordered and sorted based on the quality of the alignment. Samtools sort SAMPLE1_aln.bam -o SAMPLE1_aln_sorted.bam Samtools view -S -b SAMPLE1_aln.sam > SAMPLE1_aln.bam Minimap2 -ax sr reference.fasta SAMPLE1_trimmed.fastq > SAMPLE1_aln.sam Here is the script I use: # align reads to reference sequence with minimap2 I want to have the name of the fasta sequence to be the one of the original sequence file, not the reference. The problem is: my final consensus fasta sequence is always named after the reference sequence. I am assembling a virus genome from IonTorrent reads based on a reference fasta sequence, using a combination of Minimap2, Samtools, bcftools and such.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |